EST 682666 is a singleton


Sequence

>682666 (1 EST) Length=161 CATGTTCTGGCCATTGTGATGATGAAAGAAAAACACTGCTGTATTTTTATTACACTGCATTCTTTCGAATAAATTTATCT CTCCTTAAGTTGTTATTTTTCAGTAGTTCCGAANNTTAGCTCATTACCGCTCTTTTTGTAATAAAGTTTCATTTATCAAA C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 682666: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826661549494AA056815SWMFCA787SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:28:21 on Sun 19 Nov 117.