EST 682667 is a singleton


Sequence

>682667 (1 EST) Length=180 TTAAGGTGATCGAAGACAGAAAGTAAAGTTTGATAAGTTTTAATTACTAAAAGTTATATTAATGTCTTACCTTTCCTATC ATTTTTCCAAGTCTGAAAATTTGAACAATTAAAAAGAGTTCGAAAATGGTACAACTATCTTTGATAGTATTTTAACATTT TTTTTTTTTTTTNNAATTNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 682667: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826671549495AA056816SWMFCA794SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 12:14:32 on Fri 17 Nov 117.