EST 682674 is a singleton


Sequence

>682674 (1 EST) Length=133 CCAAGTTTGAGTTTCACATAGGAATAAACGTGAACAGACGTGAGTGGATGTGAATAGATGAAAATAAACGTAACATTACT GTATTTCGTCGAAAAATTATTTATATTAAAAATGATGAAAAACCCCAACAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 682674: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826741549502AA056863SWMFCA863SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:56:8 on Sat 18 Nov 117.