EST 682692 is a singleton


Sequence

>682692 (1 EST) Length=96 ACCGATTGATTATTTAGAATGCTGTTTGTGTGAGTTTTTTAAAAGTATATTAATATTTATGGATAATTATATTTACTGGA AGAATAATTTTATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 682692: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826921549520AA056881SWMFCA993SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:39:51 on Fri 17 Nov 117.