EST 683772 is a singleton


Sequence

>683772 (1 EST) Length=558 GTTGTAGACAAAACATGTTCGCAGTCTGGGATAAGTAAAAATGGAAGTTTTGGTACTGAACATTTCGATGCTATTAATCA GAGTGTTCAAGAAAATCAATATAATGATGAAGGTAGTACTGGAAAGCAAAGCTCGTCAGAAATATCGGAAAATAAGGTTG TCGAAACTACTCATGACAGTTCAGAGACAGCAGAAGCTCGAAATATTTATAATGCTGGAAAGTCGCATTCACGAGTTCCG AAACACTATGTCCCTCCAGGTTGGATATATCACGGCGAAAGTGATGGATATCGATATTATATAGGTTGTGCANGAGAGAT GTATNCGGTGGATAGAGATGGCTACTGGTACATGCAGGATGGCAGTGGCAATTTTATCCCTTACAATGGTTATCAATATA ATCCCGGAACACACAGTTCTATATTTCCACGTGATAATCAAGGACGGTTCTTTTTGCCAACAAATGCGCCGTTGGTGAAA AAGCTTTCCCCTGGATACCAATAATATGCCCATTTCCCCGTTCGATACACAACTCCTTTGCCTACTTTTCCTGTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 683772: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6837721550531AA057891SWMFCA886SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:19:28 on Mon 20 Nov 117.