EST 683782 is a singleton


Sequence

>683782 (1 EST) Length=197 TTTGAGCACAATTCTGGGAGGAAAAATAATATTATTGTTTGGACAATTATTGCAACTGCAGAAGCTAACATCGACAATTT TGTCGAGATTTTACACTAAAAGTGAAATTGTCTTATAATAACAACAACAATAACAATAAGAAAATACTGTAACAATTACT ATTTGTATTCATTCATATTCATACTATTATACAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 683782: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6837821550541AA057901SWMFCA897SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:49:5 on Fri 17 Nov 117.