EST 683786 is a singleton


Sequence

>683786 (1 EST) Length=552 TTTGAGGTTATCACACGATGTTCTATCCATGCTATATTGATCTTGGAAAAGCAGCCAGGGAGTTATTCACAAAGGGATAT CACTTTGGCTCTCTGCGAGTCGATGCATGTTCGAGATCAGGTGAAAACCAGGAGGTTGAGTTTTCTAGTGCTGCTGTACA CACTGTTGCTACACGAAAGCTTGCTGGAAATTTCGACGTTAAATATCGTATGCCTTCGTATGGTGTGGTTCTGACAGATA AATGGAATACGGAAAATTTATTGGGTACAGTTGTCGGAAATACAAGACCGCTTCGCTCGTGGTTTAAAACTTACATTAAA TTCATGGTATGCTCCACNCTAATGGCAAGCGATCAGGTCCAATTGAAGGCTGAGTGGGTTGAAACAGAAATGTTCACGTT GTTAATCCTTGAATGTTTGGTTTGGATACCGGTCCCACATATCCAGTTTTTCCTGGAAGTCCACTGGTGTTGCATGGGTT GGTTGAATGGGAATTACCAAACGCGGTTTGAAGTTTCCAACCAGTCAATTCCAGAATTCTTAATTTTGCGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 683786: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6837861550545AA057905SWMFCA903SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:21:31 on Fri 24 Nov 117.