EST 683816 is a singleton


Sequence

>683816 (1 EST) Length=568 TCCAAACTAAGTCGGTTAACATTATGGGAGGTGTTGATGACAAGCNTNACATANCCTNTTCCTTTTNCTCTATTCACAAT AGAACATGGGTGACCAACAGAGCGCTGAGTGGTACTAATTTGCAGTGTGATCTTAGTTATGTTTTGTGTTGTGTTTTATC TATTCCTACATGATAAATATGTTTATATCGGGATGTAAACTGATCAGAACATTGATGTTGGAAATGGTTCTTTTTTAGTT CACGTTCAAGATCGCGCAGACACAGCTCGCGGAAGCGTAGTCATTCGCGTCGTCGGTCGCGGTACTTTTTTTACTTTGTT TAATTTTTGAAGCAAATTCATAGAGTAATAAATGAATATCAAAACCGTTTTGCATTTGCGAATCGTGAAAGAAGATGACT ACTGATTCCAGTTTTTTTGATCCAGTGGTCTCTTGTCATTCCATGCCGAAAAGTTTTGGCTCGCACTACCATTTGATATT TTAGCAAATATTCCATGGTAGGACGGAAATAGGTTATGTTCATACATTTGAAATATTGTCCCATTTTGTGTACCCTAATT GGTATCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 683816: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6838161550575AA057967SWMFCA942SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:49:22 on Mon 20 Nov 117.