EST 683819 is a singleton


Sequence

>683819 (1 EST) Length=571 ATTTGATCTTCAATTACGAGCAATGGGTAAAAGGAAACGACTCTCAGAATGGTTTCTGATAGGAGTATGTGTATTGCATA TAATAATGGCACCCTATACAAAAGTTGAAGAAAGTTTCAATGTACAAGCTATTCATGACATCTTATACCACCAGCTGAAC TTTACCAAGTGAGGCTTGTGCTTGGTCTAGCAGTTCTATTCGCATTTGGTCATTTTGCTCGACAGATTGACAAAAACTTT GGCAAATTGTCAGGCGATTTTCTAAGATTAATTGTAGCAACACAGTTCCATTTCATGTTCTACTGTTCCAGGCCTCTTCC AAATACATTTGCCTTACTTGGAGTACTTTGGACCTACCAGAAAATTTTGGATGGACAGTGGTTATGTTGCAGCACGAAAT TGCTACGGTTTTTACATTACTATTTCGATGTTGAACTGATTTTGTTTTATGGCTGTGTTTTCCATATGGCCTGTTTTAAC ACGCCAACTGTCCCTGTTCCGGTTGGAATGGTGCTGTTGTTCCATTGCTTGTCGACTGCTATGCTTACTCCTGGGCATAT CTGTACCACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 683819: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6838191550578AA057970SWMFCA946SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:37:43 on Fri 24 Nov 117.