EST 683825 is a singleton


Sequence

>683825 (1 EST) Length=548 TGAACAAGGCTATATCAGACTTATTTTCCAAGGACCTCTAGACTAACAGCTGTCCTCTAGGACTACATTATAAGTTTATA AGCTAAGTGAGTTGGGTTTCTGACCCCTTGTCCTTGTAAGTTTCTCTGCTCTGGTCATTTGCATTAAGATGAAGAATTTT TAAAAATATTTATAATAGCAATTTCTGAGACAAATCTGGGAACCTCAAGCAAAGGAATTTTTGAAAGTTCCAGACTTCTG AATTCTGAGTTTTGAAAATATATTTTGAGGAGAAAAAGACATAGTCTAATTTGATGCCTTCGTTTTAGTGTTTTTGAATC ACCACCCATCCTCAGTATTGAGAAGTTGTTCTGTGTAACTGAGGGGCCTGTTGGTTCAAACTATGTTAGTTTACAATTTG TTGCAAACATTGTAAAATACAGCAACATGTTATATTAATTTTTTTCCTATTTATCCTTTATCATAGACAATACCTTAGAC TGTTGTGAATAGAATTAGCATGTTTAATGAAGGTGTTCCACACTTTTGGTGTGAATGGTAGTTTANGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 683825: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6838251550584AA057931SWMFCA952SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:41:18 on Wed 22 Nov 117.