EST 683827 is a singleton


Sequence

>683827 (1 EST) Length=547 ATGAGTTCCATTAGTGCTGAAGAGACGCCATGTTTGGATGAACGAATGGCAATTACAAGTGGTACTGAAAATAATGGAGG AAGTGTCTCTAGTGCTGTTGCATCAGCGAATGAGTCGGCTATTCCTCGACTGTCATTTGCCTATTCAATGACATCATCTG GCGATGCTCATTCGGGGTTGTCGCACTCAGTTGAATGGCCTGAAGTGGACGGAGTGTCTGCAGGCCGAGCTGCTGCTTTG GGAGCCCTTTGTCGCATTATATGTTCCAAGAAAAGCAAAGAAACCATAACAGATTCTCAGCTAGCACAATTCTACAAAGT TATTTACGAGGCACTACTGGAGAAGGATCGCTTAATACTTTGTGCACTTATTTATTTTGGTGGTGGTATTTTTCCGTCTA TCTTTAAAAAGTGTTGAAATACTTTTGCCACAATTCCGTTCAAACACTCCGAAATGATTTACACGGAGTCTATGAAATCA AGGCTTCCATCCATCTATAGATGAAATTCAAATGCCTTCCTGCTTGTTTGAATGCCCTGTCATCTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 683827: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6838271550586AA057933SWMFCA954SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:32:6 on Mon 20 Nov 117.