EST 683832 is a singleton


Sequence

>683832 (1 EST) Length=495 AATGGGAGTGATAAATGAGGACAAACAACAGACGGATGTNAGCTGGGTAACAAGCCTGGTAACCCGTGCTCATGCTGAAG GATTATCATCAACTGAATTCGGTGCTGTCTTGAAAAAGCGCATAATAACATCTGGTTGCAATGAACAGCAATGCAGAGCC ATCGCTTCAATGCTTCTTCGTTTTGCTACGGCATCANTGACACCTGATCAACGAATGCTTTCCTGTCTGGAAGCATTGGT GAAAGCAGAGGTACTTCGATGGGCTGTTTTCATTGAAGTGATCGCTGAGTTTCGGCAGTTTTCACGTGAATACTGCATTG AAGCTCTGGCAACGATTTTACGGAATTCAGTTCCATTACTGAAGTGCAATTACACATCGGAGAAAGAATGTGTGGAATTG TCGGGATCATTGATGACTGTTCTAAATTGGTGCTTATTGGCTTTGGAATACTCCTTAAAAAAAAAAAAAAAAACCCCAAG GGGGGGCCCGGTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 683832: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6838321550591AA057938SWMFCA959SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:32:39 on Tue 21 Nov 117.