EST 683835 is a singleton


Sequence

>683835 (1 EST) Length=556 CAAGTTTGAGGCTTCACAACGTTATAATGAATGTGGACAACATCCAATCTATCATACATTAGGTAGTAGTGGCGCTAGTG TCGGTGGACATTTGATACCACAATTAGCGCTTAGTGATGATGGTGATACGTTATGTGTAAGAAGTGATTCAGGTCGAGCA TCATTACGTATGCCATCAAAACAGGATCATCAAGTTCAGGCTGGACCAGGATTTACATCAATTGCCGGATATCATTCATT GGATCGAAAAGCACATTTACTAAATTGCTATCGAATATCCGATGATAATCCATATCGGTTAGCAGCAATTGGACAGCAAA CATCTGCTGCTACTTTAGCAATGGTAAGTCCTCGACATATCGCATCAAATCGACATCAATTTACATTAGCACAGCAAAAT ATGGAACATAACCTGATTAATCGACATAATGTTGCTGGAAGTTCATTGTCAAGTTCGTAAATGTCAAATGGAAAATGCCA TATGCTAATTATGCTCCACCGTGATGCAAATCTTCCACTTCACAAACTTTCCGAAGAATGGTATAAGAACACCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 683835: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6838351550594AA057941SWMFCA963SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 11:50:47 on Wed 22 Nov 117.