EST 706157 is a singleton


Sequence

>706157 (1 EST) Length=535 CCAAGTTTGAGGTTTTTGCATGGCAAATATTACGTGAATCAGTTACCGACCAGGAAACTTCGAAATGTGCATATCTCCTT AAGAACATTTCATGGTGAAACTGCAGATCATCTCTTATCTCGGCAATTACCAAAGATACGCCTGGTAGTAGAAGCAACAA TGTCCTATTTCAAGTGGGATCAATTAAGTGATGAAAATCAGTTAACTAAAGCTAAGCTGTTACTGAGTCATCTAAAAAAT AACGCCAAAGTGCGAAATTGGACTCTTAGAGAAGGACGTCCAAATCGGATATCGAATACGATGGATGCAGTATGGAAACG TTACGCAGCTTTCCTCGGACAAACCAGTCTTGCTACGGTGGGTTTATTACCAAGTCATATAAGTCAGCTCAATCGATAAA TTCAACGAACAGTTCGATAGTCTACCTCATGAACTCTTTTGTTTCACTTCTTTACAGTCTATCATTGTGTATGTATGCAT TCCTTCCATTGCAAGTATAACCTTTGAATGAAATTAAACGAACCATCCTAGTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 706157: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7061571592575AA072502SW3ICA1503SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 16:7:41 on Tue 21 Nov 117.