EST 706159 is a singleton


Sequence

>706159 (1 EST) Length=607 TTGAGTGATTAAATTTTTGCTGTCATNCGAAAAGTGTACAAATAATGAATACATCAACAGACTTTGAAAAAATTGCAAAT GATTTTCTTCTTCTAGTTAGAAAATATATTCGACTATATTACAAGCCAGATATCAACGAGGGTTATCAAAAATATGACAA AAGAGAATTGCAATTAATGGATGAGTTTTTCAAGATTAAAACTCAATTAAATGCGGCATTGTGTAATACTATTGATATAA AAATTATTGCTGAAAAATTATGTCAAATAATTGATCTCGGAGAAGAATATATTAATGAAATGGAAGACGATAATAAAATT CCGAATTGTTTACTGCTACGAAATATTGCTGCTTATATGACTCCATTATTAAAAGTATTTGGTACTACATCGAAAGACAT AGATAATATTTTCTCTGCTGATTTCAGTGAGATAGTAATTTGCAGTCCTTCATCGAGCACTTCAGCTCATGAGCTAATTA TGCCTTACGTTAGCGCACTAACTGTCTTCCGTGAAACCATTTCGGAATTGGCTCAGCAACGGAATGTTAACGATATCATT AAGGGAATGTGATCGCCTACGANATAAAGTACTTCCCGGAATTAGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 706159: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7061591592577AA072504SW3ICA1509SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 5:8:35 on Sat 18 Nov 117.