EST 706172 is a singleton


Sequence

>706172 (1 EST) Length=562 GTGGAAATGAAAACAACAAAAAATGANCGACTGATTCCAATTTACTGTTTTGAAATGCAACAGTTGATGCACTTATGCGC TATACGATGGCTTCTTGGTGGCTCAGTTCGATTCGTCAGACTGTCACCAAAATGTTATGTTAAACGGAAACGGAGAAAAT TTATCGATCCTATTGTGGTCGGGAAAACACCTAGTAAGAAGAAGGTTGCCGAAATTTATGAAGATATGAAAGTGGGAGAA CTGGCCAAAGTGTTGGGAAGTTCTGACGAANAAATTTTCCAAGTGCTCAAAAATATAAATAATTCACCCAGAATCAACAA CGAAAAGCTGGATATGTCTACTATCACTACCGTAGTTGGGGCTTTTGGTCTTAAACCAAAGCTGATACCACATCCTCGAA GTATCGTCAGTGAACATTTTGAATTGGATGCATTTCCACAACCGCCACCTCCGGAAAATGAATTGAGAAGACGTGCGCCT ATAATTACTATCATGGGACATGTTGATCATGGAAAAACAACGCTTCTTGACTGTCTAAGACATCTCAAATTGTGGAAAGC GA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 706172: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7061721592590AA072517SW3ICA1523SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 2:49:28 on Fri 24 Nov 117.