EST 706178 is a singleton


Sequence

>706178 (1 EST) Length=518 GAAAAACATCCATCCTATTGCCAATCAGGGTCTGTTATCCCTTCTTGTACACTGGTGTGTGGTGGAACATTCCATAAGAA GACAGTTGGAATTCACTGGAACGGAGCTCTGTGAATTACGTTTTTCTAGTTCCTATCAGCCATGGTCAGTAGTGGAGTTG TAAATGGGTCTTTGTTGTAAAAGCAAAGAAAGAAAAAAATTCCTTGGAACTGGACATCTGCAAGACTTGAACTATCGTAC CGAATTTCAAAAGTGAAAATTGCTTGAAAGTGATGCTTTTTCCAAAAATGACTCATATTTCTATATTTACAATTTCTATG GCCGAACAATGTTCTTCACTATGTCATACGAGCAATCCCAAATGTGAGCAATGCAAACAATNCTAATGACCGAGCATTTC ANGGTAACGACTAAACCATTTACTCNAAATTGATTGGGANANAAATTCTAATCTTCCGTAATGCGTTCCAAATGCTGTCA AACAACTCTGTTCACTTTNCGCTGGGCTTCATCTTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 706178: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7061781592596AA072523SW3ICA1531SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 13:44:38 on Mon 20 Nov 117.