EST 706193 is a singleton


Sequence

>706193 (1 EST) Length=349 ATTTTGCACTTTTTATATGGTTTCTTTTGTAGCGTACGTATTGACCAATTCTAAAATGATTTTGCAGTGAAAAAACATCG TGTTTTCTGGCATGGGCAAACTTGGAACATTTTTTCATATATGTATGAAAAATGCGTCTCTGTGACTTGCAGCTTTGTTG CAGGACATTCTCAATTGCTGGACATTTAATCCAGTGCGGTTGCGTTAATGATTTCGTCTCAACCCTGTTACAAAGCTACA CTTTATTGTCGCTTTGCAGTAAATGTATGCGAAGTTTCAGTGCATGAGCTAGATTGATTATTTGAAATACATTGCGTTGT TTACGACCATTTAAGAATTCTATTGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 706193: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7061931592611AA072485SW3ICA1629SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 2:29:38 on Thu 23 Nov 117.