EST 706223 is a singleton


Sequence

>706223 (1 EST) Length=286 CGGATGAGTCTTTGTTAACTTATATACCCCAAGAAGGTCTACTATCTCGAGAGAGTTGGTCCGATGTTTTCGAAAATACT CATAATGATCATATTCCATATTTACCATTCCGACGACTTACACGGAATACTGGTTCAGGAGATGAAGCACGCTATCAGAT CCGTCATGTGGGTGACTTACCAATGTTTCGATTTGGATAGTCCGATATCTCTCATTTCTTTATGCCTATTTCGTATATAT GGCTAATGAAACATTGAATTTGGTTATATTAAAGGCTGTTGAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 706223: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7062231592641AA072540MB4SLD062T3Brugia malayi L4 JHU93SL-BmL4


Date: 13:30:40 on Fri 24 Nov 117.