EST 709232 is a singleton


Sequence

>709232 (1 EST) Length=349 CGGATAGATATGCACCGAAACATTTCTACATAATGATTGTTGATAAGATTATTGCATTGTTTAAGTGGTAATTGTTTAAG CAACTATTTCATAAAATCTTATGAAGCAACCGCTTCATAAGATGGCAAAACAATAATATGATTAATTATTGTTGATATGG TTATATAAGGAGCAATATTTGTCTTCTGTTACATTCTTAGTGAGTACGGTTCCTTATCTTGGTGCAACAGGAATAAAAGG TTTAATTTTGATGTTTTAATAGGACGGGTTGAACAAATAGGGTACAATGTTATTCATGTTATGATAATGATGTTAAATAA ATAGTTGCATGAATAAAAATTATTTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 709232: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7092321613906AA074002SW3ICA1656SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:49:49 on Thu 23 Nov 117.