EST 715541 is a singleton


Sequence

>715541 (1 EST) Length=209 GGAAAGTCCCTTTTATCCGTCCAAAAACTTTCATTTGTGAAGAATAATGAAGAAGAATGAAATTATTATGACATTTCCGC AATTCTCTGATGTCAATATGCGCCATTACTTCGATGCAACTGTGCTTCCTCATATTTTCACCACTATTTTGATTTGATTC CCTTATTGATGAAGAAGGTCTATTCGCTGATAAAACGGTTCCGTCCTCN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 715541: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7155411619212AA080303SW3ICA1541SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 4:43:20 on Wed 22 Nov 117.