EST 715562 is a singleton


Sequence

>715562 (1 EST) Length=416 ATATCGAGCGGACTTGGTTCAAATAAATAATCGGTTGTGATTGTAAAGTTCAATGTCGTCAATGGACGCCGAATCGTCGG AAAGTTTCCCGGGAAATAGTGAGAAGTCGGTAGATCGTTCTCGTAGTGATCCACAAGTTGTGGGTTTTTCAAACGCAAGT TCAGTTAAAACTGACACGGTTACAAATGGTGAAAAAGTCATGGAACAGAAGCAAAAAGGAGGATTTGCCCAAATTTTGAA CAGCGAACACGGCGATAGTCTTCATGCCATTTCTGAGGTTAATGGAGCTTTTAATTTTGTTTGGATTTCTTATACACTTT TTTCCAGATGGTGTTACCGTAGTTAAAATTATAATGAGAGATGTTTCGCTTGTTTAATTCAGGCTTCTTCCGGAAACAAA GGACTGAGGGATCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 715562: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7155621619233AA080324SW3ICA1684SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:29:32 on Fri 24 Nov 117.