EST 724459 is a singleton


Sequence

>724459 (1 EST) Length=417 GTACGANCCCTTGAATTTTTTATATTTCAAAGAAAAGAGTAGCTTCCGTATAAACATTTTATCCCACAAGGAGCTATAGC ATCATTCCATGGAAATTTNGCTACACGTGAACCTTTCTCTTCTTTTCGTAGAAGGATACTTATTCACAAATNTNGTTTTA TACATATTTGAATGTTATATTAACGCTTTAGTAGAATACTGTACTGNTTGTATGGATTATTTCTTCCTTTTCCTTTGAAG TTAAATAATAATGGTGAAGGTTAGCATTTGTTTACAGCTTACTCATCGTTCACTGTGGCAATTCTTTCAATGAATACTAG ACAAAAATTTACCTATGAATGTGACAATTTCGGGACAGATAAAAATTGGGTGTATTTGGGAATTATGGTTATTNGAGATT GGGAAGAGAGCATCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 724459: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7244591631369AA088142SWAFCA002SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:38:43 on Sat 18 Nov 117.