EST 724476 is a singleton


Sequence

>724476 (1 EST) Length=491 GTTACATGTTTGTTTCCAACATTATTGTGCACTTATTTCTTTCGTGACCCAGCAAGAATTATACCAGGCAATAAGGATCT TGTACTAAGTCCTGCCGATGGTGTAATTTCAAAAATTGAAGAAGTTAGTTACCCTTTATCAACAAACAATGGAGAGGAGA AGAAATTTACACTTGTTAGCATATTCTTGAGTGTGTNGAACGTGCATGTGAATCGTNTACCAATATCCGGNACAGTGAAA GAAATGCACTATAAAAAAGGTAAGTTTGTTTCTGCAATGAGCGATAGATCTAGCAATGAAAATGAAAAGCAGGTTATTGT GATTGANTACACAANGGGAAAAGAGATTATTGTAGAACAAATAGCTGGATTAATTGCACGTCGNATCGNTTGTNATTTAN GAGTATCTCAGAGCGTCAAAGCAGGGTGGAGAGATTNGGGAATTATAAGATTTGGCAGTAGAGTGAACATTTATGTTCCT CCTGATGTNGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 724476: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7244761631386AA088159SWAFCA025SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:1:47 on Fri 24 Nov 117.