EST 727181 is a singleton


Sequence

>727181 (1 EST) Length=384 AAAAAATCCATTACGAACCGAACTGCTGGTTGCATCAGAAGAAATTGACCAGTGGTACACTGAAAACCATATGGAGTATT CATTTGGTCGGGTAGATTTGTNTAATTTCGAGAATGGTTCTTCTAAAAATGTTTCACCGAATTCAAAACCAAAAATCACT GCATCGGNAGCACCATTAAAACAGGAAGCAGATTTNTCTCATCAAGATGAAGCCGAGAGGTTCGGGAGAAACGACAAAAT GGATAAAAGTGGAATACCTGATNTNTTTAAATTGAGTGCAGGTGAGGCACGCAGTCGATTGGTGAGTCGTAAGAAAGATC CTCGACGTNACACTCAAATGAGTNTGAAGGAGAAATATNAGCTAGNCTCCAACATGTAATACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 727181: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7271811634826AA089347SWAFCA080SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:45:14 on Wed 22 Nov 117.