EST 727196 is a singleton


Sequence

>727196 (1 EST) Length=224 CTGAACGTCGCGTTAAAATTCATGCTGAAGATACAAAAGAGATAAACTAATACCTTTGGTTCAAATTGAAGGTTTGTCAA GCATTAACCGTTGTGATGTTAGCATGTGAGGAGGCACCACTCCCTAAAATTTTTTTTTCTTTTCTTNCCTTNGGGGGAAT NCATNTCTTAAAAATGCTTACGATATTGATTTTATTAGTTGTTATGANCCCGTGANTNTGTNTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 727196: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7271961634841AA089362SWAFCA62SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:53:22 on Mon 20 Nov 117.