EST 727213 is a singleton


Sequence

>727213 (1 EST) Length=436 GATGGAGATGATCAAAAGTATGGAGGTTTAAGTGATACCTGGCCACGAAAAGGAGTTTTTTTGCATACTGGTGCTGCTGT GGGTGCGTCATCTGTTCTGCTTATCAAACCANACCATAATTTCGTCGGCACTGATGGAACTTGCGTTGCTATTCTTACAA ACCTGCATGAATGCGGTGAGCTTACGCAGTTAGCTATGGAAATTGTTGAAATTTTTGGTTGTGTTACTTCCATCGAAACC TCATANATATCTTTTTATTATCCATTATATTTATGAAAGAATTCTTTTGCTGTCGTTCGCATTATCCTCTTGAAAACTAT TAAGTTGTCAAGTATTCAGGCTATAAAAGTTGTTCGGTGTTTGAGTTACAGTCTGATCTATAAGTAATGAATATACATTT CGCTATATATGCTGTATAAAATAATTTTTTATTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 727213: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7272131634858AA089379SW3ICA1583SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 8:23:3 on Wed 22 Nov 117.