EST 727222 is a singleton


Sequence

>727222 (1 EST) Length=550 ATTCGTTGAACGGTATCCGTTTCATTGCATTCGATTTGGCTCTGGGAACAGATATTGCTTCAGTATATACCAGTGGTTAT TTGGTTCTTTCGTTAGCAGCACTGATTGCGTTAGCAGTTGTAGTGGCACCTCGACTGAAGCAAGAAGATTATGTTGTCGT TGATATACCAAAAAAATGAATTTTATTTATTGCATTCCACCCTTAGACTTACTAGCTCTGAATATAAAATTTCATTTTAA AGTGTTAATAATTGCACCGCCTTTTTCACTAGATACTAGGTGATTGATATTGTTTAATTCATTTCCTACTATTTATTGAT TATAATTCATTATTTATTTTGGAGTTTTCTGTGCATATTTCCGTTTATTGAATTTCTTTTTTGAGAATGAGACTCCCGAA TTCCAGTTTATGAAAAGCCATGGTTTATAATAATGTGCCCCAATTACAATCTNGTTCCCACAGTTGANCGCNTCCTTTAC NTCCCTTCCGTCNAAAAACCCTTTNGTAATTACTGGACTGGTAANTGAAAAAATAATAAATTTTTTNAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 727222: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7272221634867AA089388SW3ICA1594SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 10:33:41 on Tue 21 Nov 117.