EST 727237 is a singleton


Sequence

>727237 (1 EST) Length=475 TTTGAGTGAAATGGCCGCTCACAATATTGCTAACATCAAGTGGGATCATTTTGGCGTTTATCGACGTTTCCAGTTGCCTA TGGATGTTGTTGGTGACTTGTACCGGTTGTTACTGGTTAAAATCAATACCGTAGTTCCTGATTTTAACGGCAGACTGGGC TGGAAAGACNAGAAATTAGATGTTAAAACTGCACTGCGAAGAGCTCTGAAATCAGCAATCGTTATGGATGGAGTAGCAAA AGGTCTTCATGAAGCTGCTAAAGCTCTTGATAAGCGTCAGGCATATTTTTGTGTGTTGGCTGAGAATTGTGACGAGCCAA TGTTATGCAAAATTGGTGGAACATTATGCAGTTGAACATCCAGATACCTCCTGAATTAGAATTAAAGAACAAAAAACACT GGGTTGAAATGGATTNGGGCCTATGCCAATTCCAATAAANAAGGGAAAACCNCCAAAGGTTATTGGGATGCCCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 727237: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7272371634882AA089403SW3ICA1765SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 16:19:30 on Fri 17 Nov 117.