EST 727246 is a singleton


Sequence

>727246 (1 EST) Length=494 GGAAGATGAACTTTTATATGGGCATACATTCCCGGTATCATCCGAGGTTCTTTCTTCAAACTTTGTAATTCCAATTGGTG AAGCAAAAATTGAAGTGCCAGGCACCGATGTTACAATTGTTTCGTATGGTAAATCGATGGCGCAAGCTTTTGATGGTACC GAAAAGTTAGCTAAGCTAGGTATTCATGCTGAGCTAATAAATTTACGAACACTTCGACCATTGGACAGTGAATGCATTAA GAAGTCGGTGAAGAAAACGCATCGATTAATAACTGTTGAAGTTGGCTGGCCATTTTGTAATATTGGCGCTGAAATAAGTT GCTCAAATGGCCGAATCTGATGTTATTCGATTCCTTAGATGCACCAATTCAACGTTGTTAACAGGTGTTTGATATTCCAA TGCCATATTCAGAAGCTGTTGAAGTTATATTCGATGCCCAAAAGGTTGATCATGTTTGTTAAAAGCCAGCTAAGAAAATT CTAAATATTTCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 727246: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7272461634891AA089412SW3ICA1779SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:11:32 on Wed 22 Nov 117.