EST 727251 is a singleton


Sequence

>727251 (1 EST) Length=503 TTCANTGGTAGTATATATTAAAGGGCNGTTAGCGGTCATACTGTTCTATTTNTCAAGGAAATGGATCNTTATCNAAGGAG AAGAAAATAAGAGGAGGAANCGGAATTATCCAAAGCTTATGAACAGTTTCGTGAAGCGTTCGAANATGGCACATCGATCG CCAGTAAATCGTTTGTACGCGCTGCTGTAGTCAATGCAAATAAAGTTATGGAAGACATAAGTTCGAAACCATCTATCTAC AGTCCAAAGNATTGNAACTTGCGAAAAAAACTTCCGTCATACCAAATTCATTTGAAACAAGCAAAAAAAATCGCAGAANA AAAAGCGAAACGTATGATGGAAGAAGCTCGAAAAGCAAATTTAACAACAACTCGGCCGCCTCGACCTGGAAAAGCGCNGC AGAAAAGCAGAACAAGTNATTTGGANGCCNTTAAAGAGGAATNAAAGAGTTTGCCAGAAGAGCNGGAGCAACGAAGACAT TTCCNATCGCCAATGGAACAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 727251: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7272511634896AA089417SW3ICA1786SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:49:28 on Mon 20 Nov 117.