EST 747229 is a singleton


Sequence

>747229 (1 EST) Length=491 GTTTAGAAGAACAATTTCGTGAACTTGGTGCTAACATTGATCCATCGCAGTTGAAAAATTTGGCTAAGGAACAGCTAAAA GAACCTACTATCAAAAAAATACGGGTGGGAAAGAGTCCAGGCTTGGTTGCTAGTCGACCACCAAGTCGTGATATCCGGGG TATAAAGAATGATGAATTACGAGAGATAACGAAGAAAGTTGGACGAAAGAAACAGAGGAATTTACAATACGAAGCAAGGA AAGGTGAAGCTGACAGGCATATCTTTGTCAAGCGTCCGAAGCATTTGTTTTCTGGCAAGCGTGGACTTGGGAAAACAGAT AGACGGTAAATTTGAAGTACTGCTGAATTTGTTACTGTATCGTTAATATGTAGTAATTATCAAAAAACCCTGTTCGGCTG AATTTGAACTGATTTTGTTATCTGTTACACTGTTTGTTTTATCGCCATGCTTAATGATGTTAAGCCTGTGTTTTACTGCA TTTCTGGTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 747229: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7472291660839AA109369MBAFCE1B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:0:19 on Thu 23 Nov 117.