EST 747230 is a singleton


Sequence

>747230 (1 EST) Length=255 ACAAATCTCGGCTGAAACCCCACTTTTTAAGATCTGCTAACCAAAACATCAAACAGATATTACTCATAAATTATTTAAAT ACTGCTCTGTTGAAATGTTAAAATGAACGCATGCGAAACGCCATCTCAGCTCTATCAAATATAAAGCTTTCTTCTTATGA TGAACAGATGATGAAAGATCATTGCTTAATTTAACCATATCTCTTCTTAGAAGAGAATAGAAATCATTTGCTTTGTTACT TTCAAAACTGAACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 747230: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7472301660840AA109370MBAFCE1B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:55:6 on Fri 17 Nov 117.