EST 747280 is a singleton


Sequence

>747280 (1 EST) Length=366 TTGAGTTTTGACTATGTCGGGACGTGGAAAAGGTGGTAAAGCGAAATCGTCTGGAAAGGCGAAAAGTCGTTCATCTCGTG CTGGTTTACAGTTCCCAGTGGGACGAATTCATCGTTTGCTACGTAAGGGAAATTATGCGGAACGTGTCGGTGCTGGTGCC CCAGTATATCTAACTGCTGTGTTGGAGTATATGGCAGCGGAAGTGTTGGAGTTAGCTGGCAATGCGGCGCGTGATAATAA GAAGACGCGAATCAATCCGCGCCATTTGCAGTTGGCTGTACGCAATGATGAGGAGTTAAACAAGCTGCTGGCTGGTGTGA CAATTGCGCAAGGTGGTGTATTGCCGAACATCCAAGCGGTGTTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 747280: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7472801660890AA109420MBAFCE1G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:51:25 on Fri 24 Nov 117.