EST 747294 is a singleton


Sequence

>747294 (1 EST) Length=404 TGAAGATGAAGAACGATCCAGTGGAAAGACAGGATATGAAGAGCAAACGGAGGAAGCTCCACCTTCAACAAGTTCCGAGC TTGCTGACCGAGATGATTCGGATGAAGATGGCGAGATTGATATCCAATGCTTTGAGTTTCAGATCCGAAATGTTGTTTGT AATTATACACTTCCACTGCATATTGATTTGCATCGCGTAGCTTTAAATTCCGGCAATGTCGCATTTGACCGAGGTCGAGG AGTTTTGTTGAAGCAGAAGAGAAATCCTTCGTGTTACGTTAAAATATACAGTTCTGGAAAAATTTATATTGTCGGATGTC GCAGCGAAAGTGAATGCAAACGTGCTGCCAGAGGTGTTGCGCGAATGGTCCAAAAAACCATGGGTAAGATGATGGACGTT GTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 747294: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7472941660904AA109303MBAFCE2A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:33:14 on Fri 17 Nov 117.