EST 747299 is a singleton


Sequence

>747299 (1 EST) Length=120 AATGCACTGTTTTTGGGCATGTCAGTGCTGTATTTTCTGTTATTATTGACTGATATGAAGATGATGTATGTTTCGGGACT GATTCGGAAATAGTTTTCGAAGAATAAAGTGATCGTAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 747299: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7472991660909AA109269MBAFCE2A12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:19:39 on Sat 18 Nov 117.