EST 747304 is a singleton


Sequence

>747304 (1 EST) Length=446 TTGAGGTAAAGAATAATGCGTGGTTATAAGTGGAATGGGTTTTGTGCTACTTTGCACTACTCATTTCATGAGATTGTATT GTTTTGAAATTGATTACAGAAGATTTTATTATTGTTTGCTTATGAAACAGTACCAGGAAAATGCCCGAAGAGGGCCTTTG AATGGATTAGGCTTGGAATGTGAAATAAATGAGCCACCAATGGCTAAAGTTGGAACTCGGAAATGGCGATATCATCAGGG GCGGAATCAATTTTGGTGTGATGGTCGAATCATTATGGCACGACAAAGTTCCATCTTTCTTTTCACTTTGATGGTTATCA CTGGAACGATGGGTTTATTTTTCGTCTTTGATGCACCATATCTATTTTGGAACGTTTCACCGGCTCTTCCAATAGTTGCG GGAATATTACTGTGCCTTGTGCTATTTAATTTATTCAAGACATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 747304: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473041660914AA109274MBAFCE2B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 22:42:55 on Tue 21 Nov 117.