EST 747319 is a singleton


Sequence

>747319 (1 EST) Length=425 GAAATACTTTTTTAGTTTGTGAACGTATAAAAATGGGTGTATTGGTCGGTGGTACAATTTGTAGTTTATACGTGATTTAC ACGTCTCGCACGTGAGTCAGGGATAGCTCATATTTTAGTTTACTTGTTTAATTATGTCTGAATTAGAAGCTGTTGCAAAA CGAGCAAGCAGCACTGCAAATTACGGTGCAAGGGATAATGGACGTGGGCAACAGGAACCTACTAGTAGCAGCAACAGAAG AGGTATGGTTGGACATTATGGTCGTGGTAAAGGTAAAATTCAAGAGTCAGATCAGAGATATGACCGGAATCGTCATAATT TTTATAATACGAGCAGCGGACGAGATAGACATGATGCACACTCCAGAAGGCATATGATTCGCATTCCAAAATATTATAAA CATATTACTGCTACTTTAAATCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 747319: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473191660929AA109433MBAFCE2C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:38:12 on Fri 17 Nov 117.