EST 747340 is a singleton


Sequence

>747340 (1 EST) Length=511 GCATATTTAGCTCGGGTGCAGACTCTTGCCTTATGGTACATTGAAGCTGCACAATACACAGATAATAGTGATCCACGATG GCAGCATTATTTCTTGTATGAATCATTTAAAAGAGATGACGGTACTTCCCGTGTTGCACTTGCAGGCTATGCATCACTTG TTAGGTTTTATAATTATCCAGATAAAATTCGACCTAGGATTGCGCAGATTTTACTGTTGCCACATTATCACGGCGCTGGT ATTGGTGCTAGATTTTTGAAAGCAATATATAATGACTTAATCCAAGATCCGAAGGTTACAGACATTACAGCGGAAGTTCC TGCAGAATCTTTTATAACAACTCGAGATTATGTAAACTGCTCTAACTGCTCAACTTTGAAGGAATTCCATGCAAATAATC TTAAAAAGGGCTTCACCGAAAATATGAGAAACGCTGCCTTATTACGGTTTAAAATAAATCCAAAACAGGCACGACGCGTG TATGAAAATATACGTCTGCATCATATCGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 747340: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473401660950AA109454MBAFCE2E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 22:2:13 on Sat 18 Nov 117.