EST 747341 is a singleton


Sequence

>747341 (1 EST) Length=209 GAAGTTCAGAAGGCATAATTTTGAATCTCAAATCTTCAGTCGCTTTCAGTGAAAACTGTTATCACTTTTCATTACGTGAA TTTCAGTCTTATGTTTATTGTTGATGGATGCTACTGTAATGATAACAAGCAAACAAAACTATCGTATCATTTTATTTTCT CATTTCTGGTTTTCAAGCAGATTAAAAGAGTCAATAGAAGAATGAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 747341: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473411660951AA109455MBAFCE2F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 3:58:22 on Sun 19 Nov 117.