EST 747343 is a singleton


Sequence

>747343 (1 EST) Length=172 GCAGAATCTGTTAAGCCGGAAGAGTCATCGAAGAAAGAAGAAGCCAAGAAGGAAGAATCATCAGAAGATGAAGATATGGG ATTCGGACTTTTCGATTAAGTACATCATATATTTCTTATATACATCCCTTATTTGTTGAATTTTGTTGATTTAATAAATA TTGCTTTTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 747343: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473431660953AA109457MBAFCE2F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:49:42 on Wed 22 Nov 117.