EST 748452 is a singleton


Sequence

>748452 (1 EST) Length=389 GGTTGANTGCTTANTGGTATNANTGCGTCGTNCTGCTCGGTGCTTACTGCTGGCCCNACNCCATTTATNATCNAAAAAAT TTGCACTGAATNAAGAATGGAATAGCAGACATCNTGCANTTAGTGAACTCGGTGTAAAANGAGGATNTGAATGGATTACT GCTGTNCANAAGAAGTTTATCAGTGCTGGATTGGCCAGTGCGGTGGANGTNGATGCAGCGGTTTGTATANCAGAGGAGTT GGATCAGTTAGATGATGTGCTAAAAATTGTATACAAATTACGACACATCGAAACAACCGGTAGGATGCTGCCTTCAACAG AATACGCCCTCATCAGGCTACTTTTGAAGCATCATAAAACTGACATTCTTCTTGCAATCCTGGCCGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 748452: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7484521662323AA110576SW3ICA1731SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:22:32 on Fri 17 Nov 117.