EST 748459 is a singleton


Sequence

>748459 (1 EST) Length=524 CTTGCAACTAAGAATCGTACTTGAATGTTTTGCGTTTGTGGCATTGGCGATTTTTCCTACTTTTACAAACAAAAACACAT ACCTACTTATATTTATGTCACGCACTCGGTTATCATTGGAACAGAACTCAGCACATCTTGCAACGAGAGCGAAAAGCAAG TTTTTCGTCTTATTTTGTTGTTTTCAAGTTCCGCACGTAGGCGTTTCTCTTGCGGTTCTTCTACGATAGCACGCGTGAGA GTAATGGGGAGAAAAGGCAATGAGTAAAAAAAGCATTTTTGTATCTATTTCTAAGGTGCAGTTTGATATTTGCATCGAAA GAGGGGTACTTTTCACCCCACTCGGCACCACTAACATGAAAAATCACGAAAGAAACAAACAAGATTGTTCACTGACCGTT AAACAGATGGCAAAAGCGAAGCATGGCCTTGCGTTGAGGTAATTGGTATAGGCAAACGGCTAGTTTANGCCAGCAAGTNA NATTATGGAGGTGTTGACTTAAAACATGTTANCGTTTGCCGGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 748459: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7484591662330AA110583SW3ICA1805SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 7:32:19 on Sat 18 Nov 117.