EST 749646 is a singleton


Sequence

>749646 (1 EST) Length=297 CTTAAAACAAAAATAGAAATGGAAANGGGGNGTTTAGTTTCCAAATCATATTTTAACTCTTTCAATTTTTGCATTTCAGC AGTAAATCGTTGCCGTNCTTGTGCAACTGATATAAGTTCTGCATTTTTCTCTTGTAATAGATCTTCTAACTCTTCAACAG TTATTTTTAGTGCACTTCCTGTGACTTGTTCTACTTGCAAACGATCTGCTGAATTGGCAAGTTCTGTTTCCAGCTGTAAA TATGCATTTTGTAGATTCTACTTTCTGAATGAAAAAAAAAAAAAAAAAAAAAAACNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 749646: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7496461663650AA111760SW3ICA1737SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 8:46:17 on Fri 24 Nov 117.