EST 749653 is a singleton


Sequence

>749653 (1 EST) Length=265 TAATTATTGCTCGAATATTCGTGTCACCCAGTTGTTTCTTTTTATTCTGAATAGCAATCAGAAATTGTAGCTTCATTCTT TTGCTTAAGTTCGTAATTACCCGCATATACTATGAATGTTTACATGAAATGAATTTGAATATATCCTTAATGTAAAATTT TATTGAAGGCAACACTAAAAGCGAACCATATTCTCGGTTTATGGATATCTTAATTGCTCGTTTTTTGTCAGTACTAGTTT TCTCATTAAATTTTACATTTGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 749653: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7496531663657AA111767SW3ICA1747SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 19:12:25 on Wed 22 Nov 117.