EST 749664 is a singleton


Sequence

>749664 (1 EST) Length=599 CTTGTCACCGATGATCAGTACCGCTGTCTGTCTGTCTGTCAGCCAAGTTATGCACCATTTGCAATCAACATAAGTGTCAC CAACCACTGTCAACAACAACAACAGCAATAGTAGCAGCAGCAGCAGCAGCAACAGCAGTAGCAGTAGGAAGAAGGAGCGG TAGCTGCTATACCATTACCGCCCACAAAAGTATTGTTATCATGCGATTGTCGTTGATCGCTTGTGTTGGACTCATTATCC TATCATCTTCTATTGCTTCCGCACAGGAAACTTCAGCGGAACCAACCGACGAAAATACAACTGAAAATGCGGAATTATCA CCATCATCATCATCGGAATGTCATGCTAACGAAATCTTCAATGGTAAAACATGCAAATGCGCTCCTGGGTTATTTTATGA AATCAGATAAAGAATCAAAGTTGCGATGTTGAANATGAATGTTGAAAAATTTACTTCACGTTTTTCACGTTACGGTGCAT GCGTTGAATGATATTTACGGACGTTTTACCAAAGAATGCACNATCACCGTGTAATTTACNANGTTGGCATGANAATCCGT ACTTTGGCACCATTGGTATCTTTTTTGACATTTGCTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 749664: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7496641663668AA111778SW3ICA1866SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 18:43:35 on Thu 23 Nov 117.