EST 749673 is a singleton


Sequence

>749673 (1 EST) Length=485 TGAGTGTGAAGGTATTCGTGGGTCTTGCTACAGCATGCAGTGTCTTTGTCATCATCATGTCTCTCGTTGCTGTTTGCATT ATTTACAATGACATCAATACCTTATATGATGATGTTATGGATGAAATGGGCGAATTTAAGACTGTCGCAGATGACACATG GCAAAGGATATTATTGCTGCATATGCATCCATCCGGTAGCACTGATACAACACCAACCTTTTCAAGCCTTTTTGCAAGAT TCAAACGACAATTTCNATTTCCTGAACGATGTAATTGTGGGCCTAGTGCAGAAGGATGCCCAAGAGGGCCACCANGACCA CGAGGAGAAATAGGTGAAAAAGGGACAGATGGATATGCNGGTGGAGATGGGCCACCAGGTCCACCGGCTATCGTNCCGAT AACAACACCTGAACCACGTTGAATGCATTAATTGCCCCCCGGGACCTCCGGGACGANAAGGACTCNGGAGAAATGGGTTG AACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 749673: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7496731663677AA111787SW3ICA1880SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:29:13 on Fri 24 Nov 117.