EST 749681 is a singleton


Sequence

>749681 (1 EST) Length=481 TCAAATCAATGAGTTTTGTTGCAACGAAACGTCTGATTGCTATCATTACAGGTGCGAGTTCTGGGATTGGTAAAGCCACA GCAGAATATTTTGCTGAAAAGGGCTACAATTTGTCATTGAATGGTCGAAATGAAAAGGCGCTCGAAGCAACGGTTAAAAA TTGCATGACGAAAGGCTTAAGCAAAGATTCGATTTTGACTACAACGGGAGATTTGACGGATGAAAAAGTTGTAAATTCCC TGGTCGAGCGTACAATGGAAAAATTTGGACGAACTGACTCGTTGATTAATGCTGCGGGAATCCTAATTAATGGGAAAGTA ATGGATTGCTCTATGCAAGATTACGATTATCTGATGAATGTTAACCTTCGAATTATTGTTCAATTAACGCCGAAATTGTT CCTTATCTTATCAAAACGAAAGTTCAATTGTGAACTTAGCCNTATCNATGGTCCAGCCCCTTAGTGCGTTACATTTACTG T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 749681: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7496811663685AA111795SW3ICA1890SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:47:6 on Sat 18 Nov 117.