EST 749684 is a singleton


Sequence

>749684 (1 EST) Length=470 ATTTTTTGATTATTTGATGTGCTGTTATAGGTTAGTTGACTATGTGTTAATTTTATTTTAGTCTTTTCTCTGTATCCCAA TTTATTTTCCACGCTTACTACTTTTCAGGCGCAATATTTAATATTAACATACCTCGTTGTTGATTTGGAATATTTCAAAT GTGCTTCTTCTTTAAACTTGATTTGATGTGAATGTAGCCGTCCTAGTCCAATCATGTTGCTTCGCATTGTTGCATATTTA AATTAGTTGCTTAAATGGAATTGGTTCATAATATTCAATCTTTCATTTTAATCTTTTTTTTTAATACCTCCTTTCGTTTA TTATGGTTTTACCAAATGGAACAATTTTTCAAAACTTATTGCTTAACAACCTGTTGTGTTTATTAATGGTGTTTAATCCA TTAATTTATAGTCCCCGACAGATTANACAAAANCTTTAACAGTTATGGTTGTCTTGATANTCCTTTAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 749684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7496841663688AA111798SW3ICA1893SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 13:36:41 on Fri 24 Nov 117.