EST 749708 is a singleton


Sequence

>749708 (1 EST) Length=243 GTGATGCTAAATTATTCATCAACTTATATGATTATTGTCACATTCATGGCTATATTGCCATTCAAAGATAACAACAACAA CAACAACAATTGGAATACTGTTATTATCATTTGGAAAATTGCGAATAATTTATTATTGGTTGATCCGGAATTTTGTTTCG GGAAAAAGAGAACCGGTTTTAACCGTACGGAATTTTTATCTTATCAAATATTTATTTTCTCTCTCTCTTTTTTTTTCATT TTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 749708: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7497081663798AA111822MBAFCE2H02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:28:38 on Mon 20 Nov 117.